ID: 1136414852_1136414864

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1136414852 1136414864
Species Human (GRCh38) Human (GRCh38)
Location 16:30096598-30096620 16:30096632-30096654
Sequence CCGTTGGCTCCACTGTACCGGGG GGGAGGTCTCGCGGCTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64} {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!