ID: 1136418410_1136418419

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1136418410 1136418419
Species Human (GRCh38) Human (GRCh38)
Location 16:30117259-30117281 16:30117286-30117308
Sequence CCTCCTGGGATGGGGAGCCCAGG CTGTGGATAAGGAGGTGACTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 49, 4: 453} {0: 1, 1: 0, 2: 1, 3: 21, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!