ID: 1136430348_1136430353

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1136430348 1136430353
Species Human (GRCh38) Human (GRCh38)
Location 16:30193395-30193417 16:30193416-30193438
Sequence CCGACACCACCAGGACTCGGAAG AGCTACAGGAGCAACGGTTGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 10, 4: 105} {0: 2, 1: 0, 2: 1, 3: 2, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!