|
Left Crispr |
Right Crispr |
| Crispr ID |
1136433054 |
1136433064 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:30206729-30206751
|
16:30206775-30206797
|
| Sequence |
CCCAATTTAAAATTGCAGCTCTG |
GCCTGTAGTCCCAGCTACGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 2, 2: 3, 3: 52, 4: 434} |
{0: 26, 1: 4167, 2: 117994, 3: 255556, 4: 240736} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|