|
Left Crispr |
Right Crispr |
Crispr ID |
1136433054 |
1136433066 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:30206729-30206751
|
16:30206778-30206800
|
Sequence |
CCCAATTTAAAATTGCAGCTCTG |
TGTAGTCCCAGCTACGGGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 2, 2: 3, 3: 52, 4: 434} |
{0: 28, 1: 4950, 2: 113550, 3: 241681, 4: 245706} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|