ID: 1136453994_1136454015

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1136453994 1136454015
Species Human (GRCh38) Human (GRCh38)
Location 16:30370206-30370228 16:30370252-30370274
Sequence CCCCCCGCCGGGGAGGCCGCAGA GGCGAGGCCAGCCGAGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 161} {0: 1, 1: 0, 2: 0, 3: 37, 4: 1170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!