ID: 1136458600_1136458607

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1136458600 1136458607
Species Human (GRCh38) Human (GRCh38)
Location 16:30396016-30396038 16:30396050-30396072
Sequence CCAACTGTGCGCCAGGCCGGGAG GGCCTCTGTCCCCTCCCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 331} {0: 1, 1: 11, 2: 9, 3: 44, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!