ID: 1136476675_1136476681

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1136476675 1136476681
Species Human (GRCh38) Human (GRCh38)
Location 16:30517850-30517872 16:30517874-30517896
Sequence CCTCGTCCAAGTGATCGGGACTC GGAGCTGGTGGGAGAGATCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 1, 3: 27, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!