ID: 1136477978_1136477984

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136477978 1136477984
Species Human (GRCh38) Human (GRCh38)
Location 16:30525251-30525273 16:30525281-30525303
Sequence CCTTGCTGCAGACCTCACATTTG TCTCACCGGTGTGGATGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 224} {0: 5, 1: 7, 2: 35, 3: 63, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!