ID: 1136483153_1136483166

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1136483153 1136483166
Species Human (GRCh38) Human (GRCh38)
Location 16:30555318-30555340 16:30555368-30555390
Sequence CCGGGCCGATGAACCCACTGGTG GCGGCGGCCGCACTGCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79} {0: 1, 1: 0, 2: 1, 3: 27, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!