ID: 1136487476_1136487485

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1136487476 1136487485
Species Human (GRCh38) Human (GRCh38)
Location 16:30582735-30582757 16:30582752-30582774
Sequence CCTTTCCCACACTCCACGCAGGG GCAGGGGAAGGGCCGGCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 245} {0: 1, 1: 0, 2: 2, 3: 66, 4: 645}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!