ID: 1136487484_1136487494

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1136487484 1136487494
Species Human (GRCh38) Human (GRCh38)
Location 16:30582748-30582770 16:30582799-30582821
Sequence CCACGCAGGGGAAGGGCCGGCTG GGAGGGAAGAATAGGTGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 247} {0: 1, 1: 0, 2: 2, 3: 73, 4: 812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!