ID: 1136487941_1136487956

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1136487941 1136487956
Species Human (GRCh38) Human (GRCh38)
Location 16:30585330-30585352 16:30585372-30585394
Sequence CCCACTAGCCTCTGGGGACACCG GGACTGGGGGTCCCGGCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 110} {0: 1, 1: 0, 2: 1, 3: 25, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!