ID: 1136498758_1136498761

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1136498758 1136498761
Species Human (GRCh38) Human (GRCh38)
Location 16:30659413-30659435 16:30659435-30659457
Sequence CCTCTCGTCACTGTGCAGCCGCC CAGCGCCGCGCCTGCGACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93} {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!