ID: 1136499742_1136499762

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1136499742 1136499762
Species Human (GRCh38) Human (GRCh38)
Location 16:30664411-30664433 16:30664452-30664474
Sequence CCCCACCACCCCTCCTTGTTCTC CCCACCCCCACCCCTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 649} {0: 1, 1: 1, 2: 36, 3: 194, 4: 1181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!