ID: 1136500477_1136500486

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1136500477 1136500486
Species Human (GRCh38) Human (GRCh38)
Location 16:30667565-30667587 16:30667601-30667623
Sequence CCTTTCACGGCAGCTCCCGGGGC CTGAGCCCCAGCACCCACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141} {0: 1, 1: 0, 2: 2, 3: 42, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!