ID: 1136511012_1136511022

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136511012 1136511022
Species Human (GRCh38) Human (GRCh38)
Location 16:30738367-30738389 16:30738411-30738433
Sequence CCCTAGTGCCTGGGGTCTCTGAG CCGTCTGTCCGCAGCATGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 215} {0: 1, 1: 0, 2: 0, 3: 6, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!