ID: 1136511665_1136511673

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136511665 1136511673
Species Human (GRCh38) Human (GRCh38)
Location 16:30741644-30741666 16:30741688-30741710
Sequence CCATGAGAACAGAATGCTCTGAG AAGGCCAAGGGCTCTGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 284} {0: 1, 1: 0, 2: 1, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!