ID: 1136512677_1136512690

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1136512677 1136512690
Species Human (GRCh38) Human (GRCh38)
Location 16:30748691-30748713 16:30748726-30748748
Sequence CCCCAGGACCCTGGCGCCCCAGC GCCCCCGGGAGCCGCCATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 389} {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!