ID: 1136512679_1136512690

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1136512679 1136512690
Species Human (GRCh38) Human (GRCh38)
Location 16:30748693-30748715 16:30748726-30748748
Sequence CCAGGACCCTGGCGCCCCAGCTG GCCCCCGGGAGCCGCCATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 358} {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!