ID: 1136512712_1136512722

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1136512712 1136512722
Species Human (GRCh38) Human (GRCh38)
Location 16:30748804-30748826 16:30748820-30748842
Sequence CCCCCGCCTCCTTCAGGATGACG GATGACGCTGGACGTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134} {0: 1, 1: 0, 2: 1, 3: 13, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!