ID: 1136530552_1136530556

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1136530552 1136530556
Species Human (GRCh38) Human (GRCh38)
Location 16:30865613-30865635 16:30865629-30865651
Sequence CCAATTCAAGGTACTGGCAGTAG GCAGTAGGACTCTAGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108} {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!