ID: 1136544620_1136544632

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136544620 1136544632
Species Human (GRCh38) Human (GRCh38)
Location 16:30948424-30948446 16:30948438-30948460
Sequence CCTCCTTCCCTGCCCCTTCCTCG CCTTCCTCGAGCGCGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 214, 4: 1744} {0: 1, 1: 0, 2: 0, 3: 12, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!