ID: 1136551755_1136551758

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1136551755 1136551758
Species Human (GRCh38) Human (GRCh38)
Location 16:30985759-30985781 16:30985776-30985798
Sequence CCCGGCTCGGGGAGCTGCGGGTC CGGGTCTTTGACCAACACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 197} {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!