ID: 1136552172_1136552179

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1136552172 1136552179
Species Human (GRCh38) Human (GRCh38)
Location 16:30987634-30987656 16:30987655-30987677
Sequence CCTTTCCCAGGCTGCTGTGGGGA GATGTGGGCGGCAACTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 497} {0: 1, 1: 0, 2: 2, 3: 5, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!