ID: 1136574028_1136574036

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1136574028 1136574036
Species Human (GRCh38) Human (GRCh38)
Location 16:31112634-31112656 16:31112674-31112696
Sequence CCCTTGGGTTGAACTGGTTCGTG CCCTGAGAGCCTGGCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48} {0: 1, 1: 0, 2: 5, 3: 51, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!