ID: 1136590317_1136590321

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1136590317 1136590321
Species Human (GRCh38) Human (GRCh38)
Location 16:31214571-31214593 16:31214587-31214609
Sequence CCTTGGCCGTCAGAGTCCCATCC CCCATCCAGTGTAGGATGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 0, 3: 14, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!