ID: 1136607459_1136607465

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1136607459 1136607465
Species Human (GRCh38) Human (GRCh38)
Location 16:31346044-31346066 16:31346087-31346109
Sequence CCACCGCACCTGGCATACTTCAC CTGAATATACAAAGGGATAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 153, 4: 1270} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!