ID: 1136628583_1136628592

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1136628583 1136628592
Species Human (GRCh38) Human (GRCh38)
Location 16:31476604-31476626 16:31476627-31476649
Sequence CCTCGACGTCTCGCCCCAGCCCC TCCGACCTCCGGAGTCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259} {0: 1, 1: 0, 2: 0, 3: 10, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!