ID: 1136641531_1136641534

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1136641531 1136641534
Species Human (GRCh38) Human (GRCh38)
Location 16:31569362-31569384 16:31569384-31569406
Sequence CCGGGGCCGCGGCTTGGGGTGCA ACCGCTGCCCACCCGGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173} {0: 1, 1: 1, 2: 1, 3: 7, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!