ID: 1136641531_1136641540

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136641531 1136641540
Species Human (GRCh38) Human (GRCh38)
Location 16:31569362-31569384 16:31569392-31569414
Sequence CCGGGGCCGCGGCTTGGGGTGCA CCACCCGGCTCTTGGTCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173} {0: 1, 1: 0, 2: 1, 3: 5, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!