ID: 1136641535_1136641543

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1136641535 1136641543
Species Human (GRCh38) Human (GRCh38)
Location 16:31569385-31569407 16:31569398-31569420
Sequence CCGCTGCCCACCCGGCTCTTGGT GGCTCTTGGTCGCGGGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 238} {0: 1, 1: 1, 2: 1, 3: 5, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!