|
Left Crispr |
Right Crispr |
Crispr ID |
1136662803 |
1136662808 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:31780032-31780054
|
16:31780059-31780081
|
Sequence |
CCTAGAGACTTATTGAATGGCTT |
CAAAATGCTGGTAGTGATATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 61, 1: 1594, 2: 1936, 3: 1357, 4: 856} |
{0: 3, 1: 39, 2: 79, 3: 94, 4: 219} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|