ID: 1136672903_1136672917

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136672903 1136672917
Species Human (GRCh38) Human (GRCh38)
Location 16:31874032-31874054 16:31874076-31874098
Sequence CCCGCTGTAGGGGCACCCGGGCC TCTGGGCCCCGAGTCCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 137} {0: 1, 1: 0, 2: 1, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!