ID: 1136673283_1136673292

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1136673283 1136673292
Species Human (GRCh38) Human (GRCh38)
Location 16:31876851-31876873 16:31876892-31876914
Sequence CCCAGTTAGTTCTTCCAGGGGAG CAGCCTGCTCACCCCATCCATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 19, 4: 143} {0: 1, 1: 5, 2: 14, 3: 31, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!