ID: 1136685401_1136685404

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1136685401 1136685404
Species Human (GRCh38) Human (GRCh38)
Location 16:31991227-31991249 16:31991247-31991269
Sequence CCTCTTATATGCATGGCAGAGAT GATACAGACGTGCCTGCGTGGGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 0, 3: 7, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!