ID: 1136720316_1136720320

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1136720316 1136720320
Species Human (GRCh38) Human (GRCh38)
Location 16:32314753-32314775 16:32314782-32314804
Sequence CCCAGCTCCATTTGTTCATGTTT CTTACACCCACCTCTAGCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!