ID: 1136730317_1136730319

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136730317 1136730319
Species Human (GRCh38) Human (GRCh38)
Location 16:32405522-32405544 16:32405554-32405576
Sequence CCTAATAAACAAATGGTTGCTCT CGACATAAACATACAGAGCTGGG
Strand - +
Off-target summary {0: 3, 1: 6, 2: 2, 3: 18, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!