ID: 1136744063_1136744064

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136744063 1136744064
Species Human (GRCh38) Human (GRCh38)
Location 16:32567785-32567807 16:32567815-32567837
Sequence CCTACATAAAAACTGGATAGAAG TCAAAATACTTTGTGATAAGTGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 60, 3: 493, 4: 1446} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!