ID: 1136779105_1136779111

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1136779105 1136779111
Species Human (GRCh38) Human (GRCh38)
Location 16:32885961-32885983 16:32885979-32886001
Sequence CCCGCGGCGGCTGCCCGGCTCAC CTCACCCGAGACTCCGGTGGCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 24, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!