ID: 1136791037_1136791044

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136791037 1136791044
Species Human (GRCh38) Human (GRCh38)
Location 16:32968398-32968420 16:32968430-32968452
Sequence CCCAGCCCATAAATGTGCAGGAA AAGAAAGATGCAAATCCCACTGG
Strand - +
Off-target summary No data {0: 5, 1: 0, 2: 0, 3: 25, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!