ID: 1136791040_1136791044 |
View in Genome Browser |
Spacer: 3 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1136791040 | 1136791044 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 16:32968404-32968426 | 16:32968430-32968452 |
Sequence | CCATAAATGTGCAGGAACCAAAG | AAGAAAGATGCAAATCCCACTGG |
Strand | - | + |
Off-target summary | No data | {0: 5, 1: 0, 2: 0, 3: 25, 4: 267} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |