ID: 1136791040_1136791053

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1136791040 1136791053
Species Human (GRCh38) Human (GRCh38)
Location 16:32968404-32968426 16:32968456-32968478
Sequence CCATAAATGTGCAGGAACCAAAG TCCCCCGAGCGGTTGGGGCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 3, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!