ID: 1136818048_1136818051

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1136818048 1136818051
Species Human (GRCh38) Human (GRCh38)
Location 16:33291056-33291078 16:33291093-33291115
Sequence CCTGTAACAGGCGAAGATCTGGC TTCCAGCATCATTGCCAGCCAGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 3, 3: 202, 4: 243} {0: 6, 1: 3, 2: 1, 3: 29, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!