ID: 1136821859_1136821862

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136821859 1136821862
Species Human (GRCh38) Human (GRCh38)
Location 16:33325314-33325336 16:33325358-33325380
Sequence CCAGAATGGGAGGAGATATTCAC CCTAATATCCAGACTCCATAGGG
Strand - +
Off-target summary No data {0: 6, 1: 10, 2: 164, 3: 1368, 4: 5618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!