ID: 1136850916_1136850921

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1136850916 1136850921
Species Human (GRCh38) Human (GRCh38)
Location 16:33611706-33611728 16:33611730-33611752
Sequence CCTCCTGGACTCCACATCATCCG GGTGAGCACTGACACCTCCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 2, 3: 20, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!