ID: 1136852462_1136852465

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1136852462 1136852465
Species Human (GRCh38) Human (GRCh38)
Location 16:33623693-33623715 16:33623706-33623728
Sequence CCACTGGTCTAATCCTAACCAGC CCTAACCAGCACCAGCTGGTTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 4, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!