ID: 1136857083_1136857088

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1136857083 1136857088
Species Human (GRCh38) Human (GRCh38)
Location 16:33667140-33667162 16:33667193-33667215
Sequence CCGAAATCTCCAGAACATATTTG AGCAACTTGAAGCCTGGTGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 0, 3: 9, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!