ID: 1136910768_1136910775

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1136910768 1136910775
Species Human (GRCh38) Human (GRCh38)
Location 16:34142521-34142543 16:34142559-34142581
Sequence CCACATGGGGCTTTCGTGAGCCA TCCCCCTCTCCAGCCCAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 12, 3: 98, 4: 1537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!