ID: 1136913304_1136913315

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136913304 1136913315
Species Human (GRCh38) Human (GRCh38)
Location 16:34161152-34161174 16:34161184-34161206
Sequence CCCGCTGGGCAGCTTCCAAGAAA TTGGGTTTTTAGGTTCCGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!